Research·2 min read
By BitsMindsSource: BleepingComputer

Google Catches Hackers Using AI to Build a Zero-Day 2FA Bypass for a Mass-Exploitation Spree

Google's Threat Intelligence Group says it has spotted the first confirmed case of cybercriminals weaponizing an AI-generated zero-day exploit, a Python script that bypassed two-factor authentication on a popular open-source admin tool — and that the campaign was disrupted before it could land.

Google Catches Hackers Using AI to Build a Zero-Day 2FA Bypass for a Mass-Exploitation Spree
Share:

Google on Monday disclosed what it is calling the first documented instance of cybercriminals using a large language model to build a working zero-day exploit. Researchers at the company's Threat Intelligence Group (GTIG) said an unnamed crew was caught preparing a mass-exploitation campaign against a widely deployed open-source, web-based system-administration tool, leaning on AI-generated Python code to slip past the platform's two-factor authentication.

The vulnerability itself was a semantic logic flaw — a hard-coded trust assumption the attackers could pivot through once they held valid credentials — rather than a memory-corruption bug of the kind security teams typically catalog. That distinction matters, GTIG argued, because logic flaws are precisely the class of weakness modern language models are unusually well-suited to surface from a high-level reading of source code. The exploit script itself bore the telltale fingerprints of LLM authorship: textbook Pythonic formatting, an over-eager set of educational docstrings and a hallucinated CVSS score that no human exploit author would have included.

Google said it identified the activity, coordinated disclosure with the affected vendor and pushed a patch before the planned spree could be launched. Crucially, the company added, neither its own Gemini models nor Anthropic's recently previewed Claude Mythos appeared to be the AI used to generate the exploit, leaving the precise model that powered the attack publicly unidentified. GTIG also took disruption measures against the threat actors themselves, a step Google has increasingly favored when the alternative is letting a half-built weapon stay in circulation.

The disclosure landed alongside a broader GTIG report describing how nation-state crews — among them North Korea's APT45 and several Chinese clusters tracked as APT27, UNC2814, UNC5673 and UNC5201 — are integrating AI into reconnaissance, malware obfuscation and exploit development. Russian operators are folding AI-generated decoy code into loaders such as CANFAIL and LONGSTREAM, and a separate Russian operation dubbed Overload has begun using AI-cloned voices to impersonate Western journalists. Taken together, GTIG argued, the past quarter marks the moment offensive AI shifted from speculative threat to observed tactic — and the defensive side will need to catch up faster than the disclosure cycle has historically allowed.

Want AI news before everyone else?

The morning's most important AI stories, straight to your inbox. No fluff.

Related Articles

GTCGTAAACTTCGAAGATATAATAGGGTGTGGTTCCACGGTCGCAAACTCGCACTGTTGAAATAGAGGGGAATATCGGCACTAGGTCTGCGATACTGGTTACGTCGAGAGTACGGGATTCCCGTGTTGGCGTTAGTATGCGCGCGCGGACGGATATCCATCGTCCTTATACGCTCCCCACACCCGGAGTTCTGGGCGACGATGCCCCGACGGGCATCTTCGTATGTTGTTCGATGTGGTCCAACGACGCGCATATATCGATAGGTTACGCACGTTACGTTAGTTACGCCGGTTACTCGAGTTACGTAAREPEAT · SPACER · REPEATBITSMINDS.COM
Research

Claude Finds a CRISPR-Like Enzyme System in Phage DNA

FOUR MODELS VOTE · MALWARE ACTS BITSMINDS.COM
Research

Cisco Finds Malware That Lets Four AIs Vote on Its Moves

Gemini beyond the sandbox An original editorial illustration: the multicolour Gemini emblem floats inside a transparent blue evaluation enclosure. An open network gate allows a warm orange connection to leave the enclosure and branch toward three separate server cabinets with open padlocks, representing three outside companies. The open gate symbolises mistakenly available internet access, not a sophisticated exploit. The companies are unnamed. This is a conceptual scene, not a technical diagram. BitsMinds editorial artwork. Article: https://www.bitsminds.com/news/gemini-breakout-hacked-three-companies-irregular . Created 20 September 2026. Self-contained vector artwork, 2.5:1 aspect ratio. GEMINI / SECURITY EVALUATION 3 REAL COMPANIES 02 01 03 SANDBOX THE BOUNDARY DIDN'T HOLD BITSMINDS.COM
Research

Gemini Broke Out and Hacked Three Real Companies