Research·4 min read
By BitsMindsSource: Anthropic

Claude Finds a CRISPR-Like Enzyme System in Phage DNA

Anthropic has opened its own biology lab, and its first result is a previously uncharacterised enzyme system in bacteriophages that Claude spotted after 21 hours of searching with about 950 agents. The system carries a repeat array reminiscent of CRISPR. What it actually does is still unknown.

GTCGTAAACTTCGAAGATATAATAGGGTGTGGTTCCACGGTCGCAAACTCGCACTGTTGAAATAGAGGGGAATATCGGCACTAGGTCTGCGATACTGGTTACGTCGAGAGTACGGGATTCCCGTGTTGGCGTTAGTATGCGCGCGCGGACGGATATCCATCGTCCTTATACGCTCCCCACACCCGGAGTTCTGGGCGACGATGCCCCGACGGGCATCTTCGTATGTTGTTCGATGTGGTCCAACGACGCGCATATATCGATAGGTTACGCACGTTACGTTAGTTACGCCGGTTACTCGAGTTACGTAAREPEAT · SPACER · REPEATBITSMINDS.COM
Share:

Anthropic has revealed that it now runs its own molecular biology lab, and that Claude has already turned up something in it worth reporting. In a post published on 23 September, the company introduced a life sciences research group, formed in the spring of 2026, and described an enzyme system found in the DNA of bacteriophages — the viruses that infect bacteria — that no one had characterised before. Anthropic calls it ART, for array-associated reverse transcriptases, and says Claude found it "with only high-level direction from our scientists."

The search itself was run almost entirely by agents. Anthropic’s scientists wrote a prompt asking Claude to comb a massive database of DNA sequences for interesting new reverse transcriptases, enzymes that copy RNA into DNA. From there, roughly 950 Claude agents worked for 21 hours and used 210 million tokens. They gathered more than 200,000 reverse transcriptases, picked out 3,500 new candidate systems, and narrowed those to the 20 most compelling, each written up as a human-readable report. Anthropic says this kind of genome mining would take an expert weeks to months.

The find came when one agent was reading the raw sequence next to an odd-looking enzyme and noticed a regular pattern. "I can see by eye a tandem repeat array," it wrote in its notes, before asking itself whether it was "a CRISPR-like … repeat array?!" It then did what a scientist would: counted the repeats, measured their spacing, compared the layout with known systems, and searched the literature for any earlier report, before filing its case for human review. ART turned out to have three parts: the reverse transcriptase itself, an accessory protein of unknown function beside it, and a long array of evenly spaced repeat sequences.

That array is why the comparison with CRISPR is being made. A CRISPR array stores a bank of different RNA guides, which is what makes CRISPR-Cas systems programmable and turned them into gene-editing tools. Anthropic’s first lab experiments show the ART array is also expressed as a set of distinct short RNAs, which hints that something similar may be happening. The company is careful to say it does not yet know what ART does. What it can say is that this combination of features has only been seen together in a handful of other systems, all of them programmable and able to cut, copy or paste DNA.

It is also careful about what was new. The underlying enzyme, from a so-called jumbo phage, had been identified in earlier studies; Anthropic’s claim is that Claude appears to be the first to notice the array and the partner protein that define the system. Chief executive Dario Amodei wrote, as TechCrunch reported, that the discovery was made "mostly, though not entirely, by Claude," and acknowledged that a Stanford team had earlier described a system "in some ways similar" to this one. Feng Zhang, the MIT and Broad Institute scientist who helped pioneer CRISPR gene editing, reviewed the preprint and called the RNA-repeat arrays "genuinely intriguing" and worth further study.

The lab itself is deliberately modest. It sits in the Bay Area, works only at the lowest biosafety levels (BSL-1 and BSL-2), handles no pathogens that can infect humans, and every experiment is carried out by human scientists. Claude’s job is the part before the bench: reading the literature, reproducing known results to check its methods, proposing functions for unexplained genes, and then attacking its own proposals, which eliminates most of them. The team uses the same Claude Science and Claude Code tools any researcher can buy, plus an in-house harness that runs many sessions in parallel. Because Claude generates hypotheses by the thousand, the group now studies which ones its scientists judge worth testing and feeds that back into Claude’s instructions.

Anthropic has released a technical report and says more experiments are under way to work out ART’s function. Until they are, the discovery is a promising lead rather than a new tool. The more concrete result may be the method: a single prompt, one day of agent time and a short list of candidates that human biologists can afford to test. If that pattern holds up, the scarce resource in this kind of biology becomes bench time, not the search.

More on Claude

Evergreen coverage we keep current — start here.

Want AI news before everyone else?

The morning's most important AI stories, straight to your inbox. No fluff.

Related Articles

FOUR MODELS VOTE · MALWARE ACTS BITSMINDS.COM
Research

Cisco Finds Malware That Lets Four AIs Vote on Its Moves

Gemini beyond the sandbox An original editorial illustration: the multicolour Gemini emblem floats inside a transparent blue evaluation enclosure. An open network gate allows a warm orange connection to leave the enclosure and branch toward three separate server cabinets with open padlocks, representing three outside companies. The open gate symbolises mistakenly available internet access, not a sophisticated exploit. The companies are unnamed. This is a conceptual scene, not a technical diagram. BitsMinds editorial artwork. Article: https://www.bitsminds.com/news/gemini-breakout-hacked-three-companies-irregular . Created 20 September 2026. Self-contained vector artwork, 2.5:1 aspect ratio. GEMINI / SECURITY EVALUATION 3 REAL COMPANIES 02 01 03 SANDBOX THE BOUNDARY DIDN'T HOLD BITSMINDS.COM
Research

Gemini Broke Out and Hacked Three Real Companies

Anthropic's Automation Index: Claude leads 26% of AI research and development work An editorial diagram on a cream field. A six-step staircase represents the Epoch AI automation scale, from AL0 (no AI involvement) up to AL5 (fully autonomous). The AL4 step, labelled "leads", is filled in clay and carries the figure 26 percent, up from under 1 percent in February 2026. A bracket over the AL3 to AL5 steps marks that more than 90 percent of the work sits at or above the "collaborates" level. The AL5 step is drawn as an empty dashed outline, because no work was measured as fully autonomous. Figures are Anthropic's own, measured in August 2026. BitsMinds editorial vector artwork. Article: anthropic-automation-index-claude-leads-26-percent. 19 September 2026. Self-contained SVG. Figures reproduced from Anthropic's published measurements. ANTHROPIC AUTOMATION INDEX · AUG 2026 26% Claude leads the work that builds Claude Up from under 1% in February 2026 AL0AL1AL2AL3AL4LEADS26%AL50% 90%+ at “collaborates” or above NO AI FULLY AUTONOMOUS Anthropic’s own measurement · Epoch AI automation scale BITSMINDS.COM
Research

Claude Now Leads 26% of the Work That Builds Claude