Research·2 min read
By BitsMindsSource: Inside Precision Medicine

Mayo Clinic's REDMOD AI Spots Pancreatic Cancer 16 Months Before Specialists, Landmark Study Finds

A validation study in Gut shows Mayo Clinic's REDMOD model catches pancreatic cancer on routine CT scans roughly 16 months before diagnosis — nearly doubling the sensitivity of human radiologists.

Mayo Clinic's REDMOD AI Spots Pancreatic Cancer 16 Months Before Specialists, Landmark Study Finds
Share:

Mayo Clinic researchers have shown that an artificial-intelligence model trained on routine abdominal CT scans can identify pancreatic cancer up to three years before patients are formally diagnosed, in a multi-site validation study published in the BMJ journal Gut. The system, named REDMOD (Radiomics-based Early Detection Model), flagged 73% of prediagnostic cancers at a median lead time of roughly 16 months — nearly double the sensitivity of specialist radiologists asked to re-read the same images.

REDMOD looks for subtle texture changes in the pancreas — patterns invisible to the human eye that suggest cellular reorganization months or years before a tumor is large enough to be called cancer. In the validation cohort, the model analyzed nearly 2,000 CT scans, including 219 patients who were later diagnosed with pancreatic ductal adenocarcinoma but whose initial imaging had been read as normal by clinicians. The system maintained 87.5% specificity on external datasets, an unusually high bar for a screening tool aimed at a disease that affects only a small fraction of patients.

The performance gap with human readers widened as the lead time grew. For cases identified more than two years before diagnosis, REDMOD was accurate 68% of the time versus 23% for radiologists reviewing the same studies — roughly three times the hit rate. Pancreatic cancer kills more than 90% of patients within five years of diagnosis, in large part because most tumors are caught only after they have spread, so a tool that pushes detection back by a year or more could meaningfully shift the survival curve. Lead investigator Mayo Clinic radiologist Dr. Ajit Goenka framed the work bluntly: 'Is there information already sitting in routine CT scans that we are failing to extract?'

Mayo is now moving REDMOD into a prospective clinical trial, dubbed AI-PACED (Artificial Intelligence for Pancreatic Cancer Early Detection), that will study how the model performs when it is built into the workflows clinicians actually use — initially focused on high-risk groups such as patients with new-onset diabetes, a known early signal of pancreatic disease. The next test is regulatory: validating retrospective imaging data is one thing, but persuading the U.S. FDA and payors that a screening AI changes outcomes in live practice is what determines whether REDMOD becomes part of standard care or another promising-but-shelved algorithm.

Want AI news before everyone else?

The morning's most important AI stories, straight to your inbox. No fluff.

Related Articles

arXiv's manuscript meter: two submissions per month On a burgundy desk, a tall, uneven stack of manuscripts and loose research sheets meets an imagined cream-and-burgundy submission meter bearing the official arXiv wordmark. A large physical counter reads 2 / MONTH, PER SUBMITTER. On the other side, a shallow brass-and-ivory tray holds exactly two illustrated manuscript sheets. Paper diagrams, fold corners, a retaining arm and a slim desk pen make the scene tactile. The meter is an editorial metaphor for the limit of two submissions per calendar month by the person uploading them, across all subject areas. The sheets are not represented as peer-reviewed or approved; rejected submissions also consume the monthly quota. The separate limit of three active submissions is not depicted, and the large stack is symbolic of submission volume rather than one person's active moderation queue. Original vector illustration for BitsMinds, 2 October 2026. arxiv-caps-submissions-two-per-month-ai-papers. Self-contained SVG with the project arXiv logo; no raster art or external resources. 2 / MONTH PER SUBMITTER SUBMISSIONS BITSMINDS.COM
Research

arXiv Caps Submissions at Two a Month as AI Papers Pile Up

GLM-5.3 · OPEN BITSMINDS.COM
Research

Anthropic: Open GLM-5.3 Nearly Matches Mythos at Exploits

GTCGTAAACTTCGAAGATATAATAGGGTGTGGTTCCACGGTCGCAAACTCGCACTGTTGAAATAGAGGGGAATATCGGCACTAGGTCTGCGATACTGGTTACGTCGAGAGTACGGGATTCCCGTGTTGGCGTTAGTATGCGCGCGCGGACGGATATCCATCGTCCTTATACGCTCCCCACACCCGGAGTTCTGGGCGACGATGCCCCGACGGGCATCTTCGTATGTTGTTCGATGTGGTCCAACGACGCGCATATATCGATAGGTTACGCACGTTACGTTAGTTACGCCGGTTACTCGAGTTACGTAAREPEAT · SPACER · REPEATBITSMINDS.COM
Research

Claude Finds a CRISPR-Like Enzyme System in Phage DNA