Research·2 min read
By BitsMindsSource: ScienceDaily

Penn Physicists Build a Light-Matter Switch That Could Slash AI Energy to Femtojoules

A Penn-led team published an exciton-polariton switch in Physical Review Letters that flips at roughly four femtojoules per operation, pointing to photonic chips that could process camera data directly without electronic conversions.

Penn Physicists Build a Light-Matter Switch That Could Slash AI Energy to Femtojoules
Share:

Physicists at the University of Pennsylvania have demonstrated an all-light switch that uses roughly four quadrillionths of a joule per operation, opening a credible path toward photonic chips that could slash the energy bill of large AI systems. The work was published Monday in Physical Review Letters (Volume 136, Issue 14) by Zhi Wang, Bumho Kim, Bo Zhen, and Li He, with He now based at Montana State University.

The trick is a hybrid quasiparticle called an exciton-polariton, formed when photons couple so strongly to electrons inside an atomically thin semiconductor that the two stop behaving as separate things. The resulting particle inherits light's speed and long-distance reach while gaining matter's ability to interact — the missing ingredient that has long prevented purely optical systems from doing the nonlinear switching that computing requires.

"Photons can carry information quickly over long distances with minimal loss, but they barely interact with their environment," co-first author Li He explained. The Penn team's switching demonstration used energy "far below the energy needed to briefly power a tiny LED," a regime where today's electronic transistors simply cannot operate without prohibitive heat. Removing the conversion penalty between photons and electrons is one of the largest untapped efficiency wins on the table for AI hardware designers.

The most immediate application is photonic chips that ingest data directly from cameras and other optical sensors, processing it without ever round-tripping through electronic signals. The authors also flag basic quantum computing functions as plausible follow-on use cases, given that exciton-polaritons sit at the intersection of optics and condensed-matter physics. Whether the demonstration scales into the dense interconnects needed for a neural-network accelerator is the open question, but the energy numbers are striking enough that groups at Intel, IBM, and well-funded photonic-computing startups will be paying close attention.

Want AI news before everyone else?

The morning's most important AI stories, straight to your inbox. No fluff.

Related Articles

arXiv's manuscript meter: two submissions per month On a burgundy desk, a tall, uneven stack of manuscripts and loose research sheets meets an imagined cream-and-burgundy submission meter bearing the official arXiv wordmark. A large physical counter reads 2 / MONTH, PER SUBMITTER. On the other side, a shallow brass-and-ivory tray holds exactly two illustrated manuscript sheets. Paper diagrams, fold corners, a retaining arm and a slim desk pen make the scene tactile. The meter is an editorial metaphor for the limit of two submissions per calendar month by the person uploading them, across all subject areas. The sheets are not represented as peer-reviewed or approved; rejected submissions also consume the monthly quota. The separate limit of three active submissions is not depicted, and the large stack is symbolic of submission volume rather than one person's active moderation queue. Original vector illustration for BitsMinds, 2 October 2026. arxiv-caps-submissions-two-per-month-ai-papers. Self-contained SVG with the project arXiv logo; no raster art or external resources. 2 / MONTH PER SUBMITTER SUBMISSIONS BITSMINDS.COM
Research

arXiv Caps Submissions at Two a Month as AI Papers Pile Up

GLM-5.3 · OPEN BITSMINDS.COM
Research

Anthropic: Open GLM-5.3 Nearly Matches Mythos at Exploits

GTCGTAAACTTCGAAGATATAATAGGGTGTGGTTCCACGGTCGCAAACTCGCACTGTTGAAATAGAGGGGAATATCGGCACTAGGTCTGCGATACTGGTTACGTCGAGAGTACGGGATTCCCGTGTTGGCGTTAGTATGCGCGCGCGGACGGATATCCATCGTCCTTATACGCTCCCCACACCCGGAGTTCTGGGCGACGATGCCCCGACGGGCATCTTCGTATGTTGTTCGATGTGGTCCAACGACGCGCATATATCGATAGGTTACGCACGTTACGTTAGTTACGCCGGTTACTCGAGTTACGTAAREPEAT · SPACER · REPEATBITSMINDS.COM
Research

Claude Finds a CRISPR-Like Enzyme System in Phage DNA