Research·5 min read
By BitsMindsSource: Meta AI

Meta Says Muse Spark Helped Crack Five Open Math Problems

Meta has published six mathematics papers written by researchers working with Muse Spark in the ordinary Meta AI chat app, and says five of them answer questions that were open. The results span group theory, PDEs, probability and optimisation, but three were reached independently by others at about the same time.

Meta Muse Spark's six math papers A fan of research manuscripts on a deep blue field. Five sheets behind carry gold check marks for the five open problems answered; the front sheet carries the official Meta mark, inlaid. Faint mathematical symbols float on either side. ∫ ∑ ψ |G| = 384 ∂ₜu λ ≥ 0 ℚₚ ≠ MUSE SPARK · THINKING 6 PAPERS · 5 OPEN PROBLEMS BITSMINDS.COM
Share:

Meta has published six mathematics papers that it says were produced by human mathematicians working with its Muse Spark model, and that five of them settle questions that were previously open. The papers, released on 2 October alongside a post on Meta’s research blog, cover probability, differential equations, group theory, optimisation, non-associative algebra and a corner of number theory that touches string physics. The model versions involved were Muse Spark 1.1 and 1.2 in Thinking Mode, used through the same meta.ai chat interface anyone can open, not a custom research harness.

That last detail is the part Meta is leaning on. When OpenAI claimed ten open problems for an internal Astra model in August, the proofs came with Lean certificates and the model was not public. Google DeepMind’s co-mathematician agent, which resolved a 1965 group theory question in May, is a purpose-built hierarchical system. Meta’s pitch is that a consumer chatbot, in the hands of working mathematicians, can now do research-grade work. Both versions it used are already a step behind: Muse Spark 1.3 shipped in early September.

The six papers

FieldPaperWhat it doesIndependent result?
ProbabilityThe strict threshold for Gaussian ellipsoid fittingPins down the sharp threshold at which random Gaussian points in high dimensions can still be fitted by an ellipsoidYes, three concurrent solutions in August
Differential equationsFinite-time blow-up for the mass-critical biharmonic NLSProves symmetric negative-energy waves collapse in finite time, a question open since 2015 and predicted by 2002 simulationsNone noted
Group theorySemiabelian groups need not be monomialDisproves a 2024 conjecture of M. Kida with a group of order 384Yes, AI agent Nilradical, 16 September
OptimisationTightness of the cycle-based relaxation for alpha-cyclesAnswers a 2026 question from Del Pia and Khajavirad on when a relaxation for binary polynomial optimisation is exactNone noted
Arithmetic physicsString two-point function = height function on a curveExtends a known link between p-adic string amplitudes and height functions from the Tate curve to a wider class of curvesExtension, not an open problem
Non-associative algebraSolvable evolution algebras and a conjecture of García-Martínez and Pérez-RodríguezDisproves the conjecture with a three-dimensional counterexample and offers a corrected characterisationYes, Hu and Wen

What the model actually did

Meta describes a division of labour rather than a machine working alone. Mathematicians chose the problems and steered the work; Muse Spark proposed and revised proof strategies, ground through calculations, drafted technical sections and suggested connections between fields. A second, separate group of mathematicians then reviewed each paper. Every paper marks which passages were drafted by the researchers and which by the model, an unusually explicit disclosure.

The group theory result shows the most concrete version of the workflow. M. Kida had conjectured in 2024 that every semiabelian group is monomial, a property about how a group’s representations can be built. Muse Spark wrote a search program for GAP, the standard computer algebra system for group theory, and the search turned up a counterexample: a group with 384 elements, catalogued in GAP’s library as SmallGroup(384, 20127). Joseph Phillip Brennan and Milana Golich, the paper’s authors, then verified it. A finite counterexample is the kind of result that is easy to check once found, which makes it among the most trustworthy items in the set.

The differential equations paper is a different kind of claim. It is a full proof that solutions of the mass-critical biharmonic nonlinear Schrödinger equation with negative energy and radial symmetry blow up in finite time, something numerical work had predicted in 2002 and analysts had left open since 2015. Proofs like this are long, and their correctness rests on expert reading rather than a quick check. Meta’s papers are not formalised in Lean, so for these the second-team review is the main safeguard.

Five new answers, or fewer?

The headline number drew pushback within a day. Some researchers on X argued that three of the six problems were already resolved, and Meta’s own blog supports the substance of that, if not the framing. For the Gaussian ellipsoid threshold it acknowledges three independent solutions that appeared in August. The 384-element counterexample was also reported on 16 September by Nilradical, another AI research agent. And the evolution algebra conjecture was independently disproved by Hu and Wen. Meta says it credits all of these in the papers.

Concurrent discovery is not the same as being scooped, and in mathematics two teams landing on the same answer within weeks is often a sign that a problem has become ripe. But it does change what the result says about AI. Three of the five open questions were evidently within reach of other methods at the same moment, and the sixth paper is an extension rather than an answer. That leaves two results, the blow-up proof and the optimisation question, that Meta can present as both open and uncontested. The company itself frames the goal more modestly than its headline: not to mass-produce papers, it says, but to help researchers develop insight.

None of the six has yet been through journal peer review, and Meta’s reviewing mathematicians, while independent of the authors, were recruited for the project. What the batch does establish is that Meta now sits alongside OpenAI and Google DeepMind as a lab putting its name to AI-assisted research mathematics, in a year that has also produced a Lean-checked GPT-6 Pro proof of Nivat’s conjecture, and that its entry came out of a chat window. The interesting test will be whether mathematicians outside Meta, using the public model, start publishing results of their own.

Want AI news before everyone else?

The morning's most important AI stories, straight to your inbox. No fluff.

Related Articles

arXiv's manuscript meter: two submissions per month On a burgundy desk, a tall, uneven stack of manuscripts and loose research sheets meets an imagined cream-and-burgundy submission meter bearing the official arXiv wordmark. A large physical counter reads 2 / MONTH, PER SUBMITTER. On the other side, a shallow brass-and-ivory tray holds exactly two illustrated manuscript sheets. Paper diagrams, fold corners, a retaining arm and a slim desk pen make the scene tactile. The meter is an editorial metaphor for the limit of two submissions per calendar month by the person uploading them, across all subject areas. The sheets are not represented as peer-reviewed or approved; rejected submissions also consume the monthly quota. The separate limit of three active submissions is not depicted, and the large stack is symbolic of submission volume rather than one person's active moderation queue. Original vector illustration for BitsMinds, 2 October 2026. arxiv-caps-submissions-two-per-month-ai-papers. Self-contained SVG with the project arXiv logo; no raster art or external resources. 2 / MONTH PER SUBMITTER SUBMISSIONS BITSMINDS.COM
Research

arXiv Caps Submissions at Two a Month as AI Papers Pile Up

GLM-5.3 · OPEN BITSMINDS.COM
Research

Anthropic: Open GLM-5.3 Nearly Matches Mythos at Exploits

GTCGTAAACTTCGAAGATATAATAGGGTGTGGTTCCACGGTCGCAAACTCGCACTGTTGAAATAGAGGGGAATATCGGCACTAGGTCTGCGATACTGGTTACGTCGAGAGTACGGGATTCCCGTGTTGGCGTTAGTATGCGCGCGCGGACGGATATCCATCGTCCTTATACGCTCCCCACACCCGGAGTTCTGGGCGACGATGCCCCGACGGGCATCTTCGTATGTTGTTCGATGTGGTCCAACGACGCGCATATATCGATAGGTTACGCACGTTACGTTAGTTACGCCGGTTACTCGAGTTACGTAAREPEAT · SPACER · REPEATBITSMINDS.COM
Research

Claude Finds a CRISPR-Like Enzyme System in Phage DNA